ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB50418.1'
Gene ID: ZHAS_00018446
Protein ID: KFB50418.1
Description: Carboxyl/Cholin esterases, B
Location: KE525348.1:1385232:1387224:forward strand[JBrowse]
Sequence: >ZHAS_00018446  (1743 bp)    All exons in this region
ATGCAACCTTTCGTGGCGGCCGTCTTGCGGTTGCTCGTCGGCCTCTGGTATGTCTGGTGCGAAAGAGTTTGGTACCGGTTGGTGCCACCGCGGACCACCAGTACCGTTACGATCGCGCCGGGCAAGGTGCGCGGTGTTAGGGCGCGGGACCGGCGGGGTGTTCATTACCATTATTTCAAGGGCATTCCCTACGCCGTACCTCCGGTCGGTGAGCTCCGGTTTAAGGTAAGGTTGGACCCGCGTACACGCACACCAGCGTTCGATCGTCGATCGACGCGATGTTAGAGTGATGGGTTAAGTTCAGTTTGGCATTTGCTAAATGACATCGCTTCCACCTTCCGATCCACGCAGAGTCCGGTTGCCCTGGAGTCGTTCCAGCGTCCCGTAGTGGACTGTTTTGTGGAGGGCAGCAAATGTTTGCAGTACGATCAAATCCTCAAGGTGCTAGTTGGCTCGGAAGATGGGCTCTTTTTGAACGTCTACACACCGGAACTTCCACGGGACGGGGATACGACGACCCTGATGCCGGTCATGGTATACATACACGGTGGAGGATTCATGTGCGGCAGTGGAGATTCGTTTCTGTACGACCCGGTACACTTCCTGCAGCACCGGGTAGTGGTGGTGACGTTCAACTACCGGCTCGGACCGTTAGGCTTCCTTAGCTTTCCCGAGGCCGGCGTCGAGGGGAATGCTGGCCTGAAGGATCAGCTGTTGGTACTGCGGTGGATCCGGCAGAACATTGCCGCCTTCGGTGGGGACCCCAACAATGTGACACTTTTTGGTGAGAGTGCCGGTGCAAAGGCGGCCTATCTTCACTATCTCTCTCCAGTGTCCAGGTAATACGTGGCTGTCTATCGGCAGAGATTGTAAGGCTTATGCAAATGTTTCACATTTTGTAGGAAATATTTCCATCGTGTCATCTGCCAAAGCGGAGTTGCCTGTTCAGACTTTGCTCTGCAGGTAAAACCGAGTGAGAAGGCGAGAAAGCTGGCCAACTGTTTGGGTTACCATGGATCTTCCGACAGTGAGGCTTTCGGTGAGTAATGTACCAGTTCTAACTTTCGGTTTACATTAACCTAGTATTTTTTTACCTCCAGATGTTCTTCGGAAAGTACCCGCTGCGCAACTGATACGATACCAGATGGAAACGCTAGACGCCAGTGAACGGCACCAGGAATTAAAGTTTCCTTTCCGTCCGGTGATCGAAGGCAGTCACCCGGAAGCGATCGTAACCGAGCATCCGCTCGACGCACTTCGATCGAACCTACCCGAACCACCGATCCCGATCATAACCGGATGCAACAGTGGCGAAGGAATGGTAGCACTGGTGGAAGCGAAGAAAAACCTCACCCAGTACAATCGCCACCCGGAATGGTTGGTGCCGGCCAGCATTCGCCTACCGACGGAGACGGACGCGATCGGGATCGGGGAGAAGGTGAAGAAGTTTTACTTCGGTCAACGTCCGATAAGCTCGCAAACTCTGCCAGAGCTAATGGATCTGCTCTCGGACAACGAGTACCTCATGGCGACGGTAACCGCGGCCGAACTGATGTCCCGCTATCAACCGCAGGTGACCCACTACTGCTACTACTTCAGCTTCGACGGACGGTACGGGAATACGAAGCAGTTGCTTAACATGTCTCACCTCCCGGGCGTCTGCCACGGTGACGATGTGTTCTACATGTTCGACTCGGCGCTCAACTGTGGCACCTTACCGGAAGATGCCGATGAAAACCGGGTACGCCAGTGGTTCGTTAAGCTGTGGACAAACTTTGCACACCACGGGAATCCTACGCCATCCAACGTTGGGGACGTGGAATTGCCCACCTGGGAGCCAGTAGCTGTTGGGCAGCGCGAGCGGTTCCGTTTGGATTGCCTTCAGATCGATCGGACGCTAAGGATGACAGCGGATCCGTTCGGGCGAAGGAGTGCCTTCTGGCGGGAACTTTTCCACACCTACGGCTATAGTTCTAGAAAATTGTCTCACTAG
Ortholog: Anopheles gambiae | AGAP005756-PA | ortholog one-one
Aedes aegypti | AAEL017553-PA | ortholog one-one
Culex quinquefasciatus | CPIJ000046-PA | ortholog one-many
Culex quinquefasciatus | CPIJ015342-PA | ortholog one-many
GO: GO:0008152:metabolic process
GO:0016787:hydrolase activity
KEGG: NA