ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB50608.1'
Gene ID: ZHAS_00018928
Protein ID: KFB50608.1
Description: AGAP005644-PA-like protein
Location: KE525349.1:532975:536901:reverse strand[JBrowse]
Sequence: >ZHAS_00018928  (2703 bp)    All exons in this region
ATGGGTGAAACCGACGAAAAGGAGACGGGACCGACGGCGACGGCGAACGAGGGTGGGAAACCGGAAACACCCCTACCGACGGGCGACGGGCCGGAGGTGGAGCCGAAGGAGACGGAAAAGCTGCTCGGCAACACCAACGGCACCACCGCAGGCCACGAGGACGGGGACGAGAAGAAGTCCACCGGTGGTGAGAAGAAGAAGAGCAGCAGCGAGAATGTGGCCAACGGGGAGGAAATTATTAACATACCGGAAGACGCCGACGGGGTGGAGAAGCACAAGGAGCAGGATAGTAAGCAGGAGGGAGAGGATGCGACCGAACCCGCCAGCAAGCCGGACAAACCGAACAAGGTGCAGGCGGAGGAGCGCGAGGTGAAACCGAAAAAGGTTCCGGCCGGAGCGTTCAAGCTGCCCGGGTTCTTCAACAAGAACAAGGAAAAGTCGAAGGAGGCCGACGGAGCGGACAACGAGCTGCTGGAGAAGGGTGGTGAGAATGGCGAGGGCAAGGAGGTGGTGGCCAAGGTGGACGAGACGAAGCCGACCGGAGCGGAGGAAAAGCCGAAGCGGGGTGGATTTTTCGCCAACCTGAAGCTGCGCAATCCGTTCGCGAAGAAACCGGCCGAGGACGGTGTGGGTGGAGATGGTGCAGCGAAGGCGGGTGACAAGGAGGAGGAAGAGGAGAAGGACGAGGTGACGGCGGAGGCGACGGACAAACCGGCGGGTGAAGGTGTGGGTGAGTCGGCGGAGGAGAAGAAACCAACCACCGGAGCGGACGATTCGGAAGGTCCGGTGCCGAAGCGCGGGTTGTTGGATGCACTGCGCGTTCCGCTGGCCAGCATCATTCCGAAGCGCTTCAAGCCGGTGGCGAGCGGTGATCCGGATGACGATATCGAGCTGGGCAAGACACCAAAGAACCGGGCCGGACTGGCCTCGATGGAGACGCTGGACGACTCGCTGAAGGATGCGGACACGAAGGATGTGGTGGACAAGACGGGCGTTAATGGCACGGATGGGGAGGCGCTGGTGAAGCCGGAGGACAAGGAGGCGAAGGATAAGGCGGCCGAGGCGGAGGAGGACGCGCAGGAGCGTAGCCTGTTGGAGCGGGTCCAGGCATACCGGTGCTCTGTTGGTAAGTGTCAACACTTTTCGGAAGATTTATAAATTTAAATAATTTTTAGCTAACTTTTCTAAAACCAGAGTATCAAGTGAAAAACTGATTAAATAACCAAGTAAATAGCTGAAAATAGGAAAATGAAACAGGAAAACATACAGGAAAACAAACTCTATTCATATACAGTGAGTCCAAAAAGTTTTCGTCTAGACGTAATGTAAGCTCAAAAAAAAATGGACAAATGGAGTGCGAGTATTCGTCTACTTGGAAACTGGCCCCCTTCATGTAGGCCTTTTTTGAAACTTCTTGACAGCATATCACAGAAGTGGAATGATATTTCAATTTTGATCAAATCTAGCAAACCATAGTCTGGAATAAACACGTTAAGCGCTCCGTTAGTTCCGTGGAACTAACAGAATCGTTTTGTAGAGATACCAGGTTATTCGAACCGACAGTCCATTTTGTTTCTTAAAAGAATATCGTCGGTTCGCACTATCGACACCGATTATTCAGTAGACGTAGGGAAATGAACAATTTTAAAAATGCCTTTGTTTACTGCTGCTTTTTAATGCATTGTTCTGGTTGTGGTTTCTTTCTAATGTCCTAAACAAACTCCATTCGCCCTCACCGAGTCCAGATATGAACCCAATTGATCATTTATGGAAGATCTTAGATGATTCTATTTGTAAACGGACAATTTCTAACAAGGAAGAGTTGAAACGCCCATTGCAAAAAGAATGGGGTGGAATACTTCCCATTGTCTCGGAATATTTGGTCCATTCCATGCCACAAAGACTAAAAAGTGTCTTTGAATCTAAGGGAGACCCCACAACATATTAAATCTGACCACTTTAGCCTTGTAGCCGTGAAAATGGAACAACAATCCGAATTAGAGGAATACTTTTTGCGTACATAATAAATACAGTTTTTGCAATATTTTTCCATAGTCACTCATGTTTTCAAGTTTTACTACCAAACTTGAATGATACATAAGAATTGGCCAATCCTCTAATCCGTTTATATTAATTCTTGAGCCTATGACGCTCCAAAATAAGGGTTTTCCAAGAAATACTCGTATAGACGAATACTTTTCAGAGTCACTGTATGAATAATGAAATATTCATTCGCCAACTTCGTTTAGTTACAACAACTATTTCAAGGCCTGCTTTTCTAACCTTAAGATGCTTTTTCTTTACTTACCGTATTTAACGTTTTCTTTGGATATTTTTCTCTTTTTCACAGATGATATTGCTATCATTGCCGGTATCGTAATCTTCCTCATTCTTGTGGCTCTGATCGTCGCGTTCACGTTCGTGGGCAAGAGCGAACCAATCACGGCTCCGGTCCGCGACGGCAAGTACATCGAAACGGTAACGAACTGTGGACGAGTGGAGGGCATCCTGGAGGATGGCTCTTTCGCTTTCCGAGGTATCCCGTACGCGGTTCCACCGGTCGGTGCGAATCGTTTTAAGGCGGCCCGACCAATCGAAAACATCGAGCACTGCTGGAACGGAACGCTGAAGGCGCACAACGCGACGCCTGTGTGTTGGCAGTTCCTGGCCGATGGTAAAAAGGACGGTGTGGAGGACTGCCTCACGCTCGACGTTATCACTCCCCATGTCCGCTACGACAATCCGCTTCCGGTGGTGGTGCTGGTCGGAGCCGAATCGTTCACCGGTGATTCGCCGGGAAAACTGCGCCCATCGACACGATTTGCCCGTGCACGCGACGTTATCTTCGTACGGCCCAACTTCCGCCTAAACGTGTTCGGTTTCCTGGCCGTGGAGCAGCTGACCAAGAGCACGCACCCACCGACCTCGGGCAACTACGGGCTGACCGATCTGATCGTCGCACTCAAGTGGATCCAGCTGAACATCCCGCACTTCGGAGGGGATCCCAAGTCGGTGACGCTGTTCGGACACCGGGCCGGTGGTACGCTCGTGACGGCTCTCGCGTCCTCCAACAAGACCGGCAAGCTGTTTGCCCGCACCTGGGTCTCGTCCGGTGCTGCCATCTTCCCTGGAAAACCACTGGCCGATTCGGAGAAGGAGAACGCGCTGTACATGCAGAAGGTGGCCTGTGAAACTGCCGAATGTCTGATGGAGAAGGGTGACGAGGAACTGCTGGATGCCGTACCGGACGTGTGGCGGCGTACCTTCCCCGATCTACCGGCAGTCGATGAGAACACGACGACCGCAGCGAACCCACGCCACGAGTGGTTAGTCCTGGACGGTAACATCCTGCAGCAACATCCGGCCGACGCTTGGACAGCGGATGTGTCCAGCGGGGTGCGGTACATGATCGGTTCAACGGCGCACGAAGCGCACAACAGCAGGCTTCACCTGAAGTACACCGAGTGGACGCCCGAGCTGGTGACCAAGCACGTCAACGAGAGCGTAATCGGGCAGGCCGGACTGACCGAGGAGGCGCTCCGACGGTATAACGCCACCTACCAGGGTCTGGTGGCGATGATCTCCGACATCCGCACCATATGCCCGCTGCTCACCATCGTACAGAAGCTCCCAAGCGCCCAGTTCTATGCCGTGTCGCAGACGGGTGGCGAACTCGGTATCGCAGACGTTGACGCCGACGTGCAGGCCATCCTGGGCCGCTACGAACCGAAGACGCCCGAGCAGCGACGGTACGTGTCCGCCATGCAGCAGCTTTTCTACCACTACGTCTCGCACGGCGAGATCAAGCACGAGCTGCGGAAAAAGCACATCGACATCGGCCAGGACGCACTCCCGACGTACGACGATGACAACTGCCGGTTCTGGATCAAGAACGACATCGTGCCGCGGTACGCACGGTTAGACTAA
Ortholog: Anopheles gambiae | AGAP005644-PA | ortholog one-one
Aedes aegypti | AAEL009240-PA | ortholog one-one
Culex quinquefasciatus | CPIJ008533-PA | ortholog one-one
Drosophila melanogaster | FBpp0075081 | ortholog one-one
GO: NA
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Up 1.18410242 0.143474763 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810