ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB50994.1'
Gene ID: ZHAS_00019039
Protein ID: KFB50994.1
Description: cytochrome P450, CYP 303A1
Location: KE525350.1:1366104:1366951:reverse strand[JBrowse]
Sequence: >ZHAS_00019039  (705 bp)    All exons in this region
ATGAAGCTGAATGAAGGCCGTGCGCTCGATGGAGAACCGTCGCTGCTGGAGCGTGTCATCAAGAGCGAAAACAACGAAAAGCTAGCCGTCATTATGGCGTTGGATATGATTCTAGTTGGCATTGATACGGTAAGCATGGCCTACGAAGACCCTACCGACTCAATCTAATGTCTAATGTCTCCATGGTAATGTGAACAGATTTCCATGGCCGTCTGTTCGATCCTGTACCAGCTCGCTACACGACCGGTCGAGCAGCAGAAGGTGTACGAGGAGTTGAAGCGCCTAATGCCGGACCCGAAGACTCCCCTCACGATCCAACTACTCGATCAGGCGCACTACCTAAAGGCATTTATCAAGGAGGTGCTACGGGTGTACAGCACGGTCATCGGTAATGGTCGCACACTACAAGAGGATACCGTCATCTGTGGCTATCGGATTCCGAAGGGGGTTAGTACATCACCACTTGGTTATTTTGGTTTGCTGGCAGAATTTTGGTTATTTATTGGTATTGGCTGTTTCAGGTACAATGCGTCTTCCCGAACCTAGTCCTCGGCACGATGGAAGAGTACGTAACCGACGCGCAGCGGTTCAAGCCGGAACGCTGGCTCAAACCGGCCCAGGGCGGGTCCGGGGATCAGCTTCATCCGTTCGCCTCGCTACCGTACGGATACGGTGCGCGTATGTGCCTCGGGCGACGCTTTGCCGATTTGGAGATGCAAATACTGCTGGCTAAGCTGTTGCGATCGTTCAAGCTCGAGTACCATCACAAACCGCTGGAGTACGTGGTCACCTTCATGTACGCGCCCGAGGGTGCCCTCAAGTTCAAAATGACACCGCGCGAGGACTAA
Ortholog: Anopheles gambiae | AGAP006082-PA | ortholog one-one
Aedes aegypti | AAEL014594-PA | ortholog one-one
Culex quinquefasciatus | CPIJ008980-PA | ortholog one-one
Drosophila melanogaster | FBpp0086937 | ortholog one-one
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Up 2.14779544 0.0026004383 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810