ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB51090.1'
Gene ID: ZHAS_00019147
Protein ID: KFB51090.1
Description: AGAP006727-PA-like protein
Location: KE525350.1:2145032:2146431:forward strand[JBrowse]
Sequence: >ZHAS_00019147  (1338 bp)    All exons in this region
ATGAGAAACATTGATCGCGTGAACGTGAAGGTCCGCCAAGGTACGGTCAGTGGCGTGAAAGAGAAGCTTCCGAATGGGAACGCATTCTGTGCCTTCCGTGGTATCCCGTACGCGAAACCACCGGTTGGAGAGTTGCGCTTTAGGGCACCGCAGCCTCTCGAGCGTTTCCCGTACCCCGTGCTGGATTGCAGTGCCGAGCGGGATGTTTGCTTCAGCCGGAACATGTTCACGCAGGAGCTGGAGGGCTCGGAGGACTGTCTCCACTTGAACGTCTATACGCCGGCCCCGGAGCGCTGCACGAAACCCCTGCCCGTGATGGTGTTCATCCACGGTGGAGCCTTCCTTTTCGGCAGTGGCAACGGTGATTGGTAGATGAGAGCTTACGGCTTCCGGCCAGCGCAACATTTATTCACGGTTGCTTTCTTTTTAGTTATTCCCCTGAATATTTGCTGCAAGAGGACGTCGTAGTGGTGACCCTCAACTATCGGCTCGGCGCGTTGGGTTTTTTACACCTGCCCAGCCAGGGAATCGAGGGGAACGCCGGCCTGAAGGATCAACTGATGGTTCTGAAGTGGGTGCAGGATAACATTTCCAACTTTCACGGTGATCCACTGAATGTGACACTTTTCGGTGAAAGTGCCGGAGCCGCCTCGGTCCATCTGCATCTTTTATCACCCGTTTCTCAACGGTACTTCCATCGGGCCATTTGCCAGAGTGGCATTTCTATTATGGAATGGGTGATGCAGCTTGATTCCGTAAACCGAACGCGCACCCTGGCGAGACTGATCGATCCCGCGGCCCGCTCGGACGAGGAAGTGTACCGAACGCTACTGAAAGCGGACAAAGTGGAACTGATGGGACTGATGTTGAACACACTGACGGCCGACGAAAAGCGTCGCGGTCTGCCGATGCCATTCAAGCCGGTGGTGGAGGAATCGATCGGACCGGACACCGTCGTACCGGTGCATCCGTTCGTAGCGATGCAGCAACCGAACCGTATCCCACCGATACCGATCATGTTTGGTAATAACGATCGCGAGGGCACGATCATGATGATGGACGCGATAAGAAAGCTTGATCTGTATGATAACGATATGGCACGGATGATCCCACGGACGGTGAATGTGGCCCCGAGCAGTCCGGCCAGCGAACAGCTGGGTGAAGAAATCAAACGGTTCTACTGCGGGTCGAAGGGTGTTACGGACGAGACCGTAAATCAGCTCGCTGACCTGATGACGGACTACCATTTCGGTATTTTGGCCAACACTTGCGCCGAACTGCACGCCCGGCATCAACCGAACTCGCCAATGTTTTACTACAACTTTAGTTACGACGGGGAACTGAATATGTACAAAAAAGTTGCTACAACTGAGCATTCCCGGGGCGTGCCATGCGGATGA
Ortholog: Anopheles gambiae | AGAP006727-PA | ortholog one-one
Aedes aegypti | AAEL005122-PA | ortholog many-many
Aedes aegypti | AAEL015264-PA | ortholog many-many
Culex quinquefasciatus | CPIJ007829-PA | ortholog many-many
Culex quinquefasciatus | CPIJ016341-PA | ortholog many-many
Drosophila melanogaster | FBpp0071604 | ortholog many-one
GO: NA
KEGG: NA