ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB51093.1'
Gene ID: ZHAS_00019150
Protein ID: KFB51093.1
Description: Carboxyl/Cholin esterases, B
Location: KE525350.1:2149385:2151143:forward strand[JBrowse]
Sequence: >ZHAS_00019150  (1584 bp)    All exons in this region
ATGGAGGCAAACCGATGCACCGTTCGAGTGTCGTCTGGCGTGATCCAAGGCGTAACGGCGCGCCTACCGAATGGCGACCCGTGCTTCCGGTTCAAGGGAATCCCGTATGCCGAACCACCGGTCGGAAGTCGTCGCTTCCGTCCACCACAACCGTTCAAACAACGGGACGAGCCCTTACGTTTGGACTGTACCGTCGAGCGATGCGTCAGTTTAGCCAGCAGTTACCTTCCGCCGGACGCTATCGGTTCGGAAGATTGTTTGTTTTTAAATGTTTACACACCGATAAACCCGACGGTGGTGGACGGCGGCTCGGAAACCTCGCTACCCGTTATGGTCTGGCTGCACGGTGGAGCCTTCTGCACCGGGAGTGCCGATTCGACGGTCTACGATCCGGAGTGGCTGGTGGCGCAGGGTGTCGTCGTCGTGACGGTAAACTATCGGCTCGGGCCGGCCGGGTTTTTGTGTTTACCGTCGGTGGGAATCTACGGCAATATGGGGCTGAAGGATCAACGGATGGCGCTGGAGTGGGTGAGGGAAAACATCGGTCGCTTCGGGGGCGACGCGGGTAATGTGACGCTGTTCGGTGAAAGTGCCGGTGCGGTTTCGACCCATCTTCACTGCCTTTCGGAACGGTCACGCCACCTGTTCCACAAAGCTATCTGCCAGTCGGGGGTTTCGACCAGTCCGATCACCTTTCAGAACGATCCGGAGGTGAAAGCAAGGCGGCTGGCGGAGTATTTCGGATGTCCAGAGGGAGCTTCCGATGACCTTGTGCTGGGTATGTCAATATCAAATGAAATGAAACGTTACAAGCTTGCATCCAGCACTTGTTGATTCACAGAAACGCTCATGAATGTGGCTCCGGACATGCTTGCCAAACATCAGAAAGAAGCGCTGACCACGTACGAGAAAACACTCGATTCGGTTTACCCATTCCGGCCAACGGTGGAAGTTCCAGACGCGGACGAACCAATCGTCACGGAGGATGTGATGGTTTTACTTAAGCGCCCGAACAGTGTGACCATTCCCATGATCATTGGAGTGACCAATGAGGAGGCCCTGTACAAAATAAACACCTTCCGTCAACATTTGGAACGGTACAAGGCGGAAGTGACTCGCTTCCTTCCAGCCTCACTGAACGTTCCATCGGAGGAACGTCTGAAGGTGGCGCAAGACATCGTAGAATTCTACTGCGGCACAACCGGAATCGCGCACTCCACCGAACTGCAGATGAGTAGAATATTTACCGACATTTTCTATCTCATCCCCGCGGTACAAGCGGCCGAACTGCAACTGAAGCATCAGAATGGGTAAGTGACCTCTTTTAAAGGTGGCACATCAGCTCTACTGATCTTTTTTGTGTGTGTGTGTCTTTCAGGAGCATATTTTTCTACCATTTCACCGCCGAAACGGAACTGAACAAATTTCGCAAACAATGGAAAGTGCCGGAGGAACATCGAGGTGCCAGCCATGCGGACGATGTTTGCTATCTGTTCCGCTCGCCGTACTTTAATACCGACGCCATCGAGCGGCAGTCCACGGGTTGGCAGTTGAGGGAAACGATGTGCCAGCTGTGGGCTAGTTTTGCAAAAACTTCCTCCCCGGGCCCTACGACGAATGGAGGTGTTGTGTGGACTCCACTGCCTGAAAGACCGGTTCCATCGGAGCTCCAATGGATGGCGCTGGAGATTGGTAACCAAGGGGTAAAGATGGAGAGTCTTCCAAACAGCCGAATTCAATTTTGGAGAGCGCTATTTGA
Ortholog: Anopheles gambiae | AGAP006725-PA | ortholog one-one
Aedes aegypti | AAEL005101-PA | ortholog one-one
Culex quinquefasciatus | CPIJ007827-PA | ortholog one-many
Culex quinquefasciatus | CPIJ016339-PA | ortholog one-many
GO: GO:0008152:metabolic process
GO:0016787:hydrolase activity
KEGG: NA