ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB52025.1'
Gene ID: ZHAS_00020206
Protein ID: KFB52025.1
Description: cytochrome P450, CYP 325F4
Location: KE525366.1:79525:80752:reverse strand[JBrowse]
Sequence: >ZHAS_00020206  (1089 bp)    All exons in this region
ATGTTGGCAAGTTTTGTCGATACTTTCAACGAGAAGGACTTTATCATGGTGGAAACACTCAAGAAATATGTCGGAAAGGGCGAAATTGATCTTCATTTGCATGTCGCCAAGTGTAACATCGATGCGTTTTTCAGTGAGTACCAGCAATAAATTCACGGTGTCAAGAGTGTTTGCTTAAATTTTATCTTGCATGTCAGGTACTTCGTTCGGCAAGGATCTTAACTCGCAAAGCCACAATGAAGCCGACGCATATCTCAATAGCTTGGAAACATTTTTCGCGCTCATTTTCAAACGGGTTGTCTCCGTGCATCGCTATCCCATGTGGCTGTATAGTTTTACGGATGATTACAAAACAGAGACAAAGTGCTGGGATGACATAAGAGCCATGTCCAAGCGGATGCTGCAGGAGCGGAAACAACACCCGCGGCAAAAAGAAGTTCAGCACAATAGCGATGTTTTTGGTCGGAAACCTGCCCTAAACTTTGTCGACAATCTTTTCGATGCGGCCGAGCATAATTCATCGCTGACGGATGAGCACATAATGGATCACATCAACACCATCATTGCGGCGGGTCACGATACAACATCAACCACAGTGTCGAACCTGCTGCTCATGCTCGCCATACATAAGGATGTACAGGAAGCGGTGTACCAGGAGGTGATGAGCATATGTCCGGATAAGTCCAAACCCGTAACGACCGAGGAGGCCAACGGACTTGTCTACACCGAAATGGTCTGCAAGGAAACGATGCGCCTATTCCCAGTGGGCCCCATAATAGGAAGAACTTGCACTGCCGAAGTAAAGCTGGATGGTAAGGATCCTCGTCGATCAATCGATCTTTGAAGAAGATTGCAATTTATTTGCTCTCCTATTCTTTTGATTGCAGAGAAACACACCATACCGGAGGGGTGCAGTGTGGTGGTGGGTATTTACCAACTTCATCGAGATCCAGCGACATGGGGTCCGGAACCGGACGTATTCAATCCGGATCACTTCCTGCCGGAAAAGGTTGCCGAGCGACATCCTTATGCCTACCTACCGTTCAGTGGAGGTCCTCGAAATTGCATCGGCATCCGGTACGCGTGGCTGTCGATGAAAATTCTTATAGCCCACTTGGTGCGAAACTATCGGTTTAGCACATCGTTAAAAATGGAAGATTTGACAGTGAAATTGGCGGTCATACTAAGGATCACGAATGGATGTATGGTGTCGATTGAAAATCGCTAG
Ortholog: Anopheles gambiae | AGAP002195-PB | ortholog many-many
Anopheles gambiae | AGAP002197-PA | ortholog many-many
Aedes aegypti | AAEL011761-PA | ortholog many-many
Aedes aegypti | AAEL011769-PA | ortholog many-many
Aedes aegypti | AAEL012762-PA | ortholog many-many
Aedes aegypti | AAEL012765-PA | ortholog many-many
Aedes aegypti | AAEL012769-PA | ortholog many-many
Aedes aegypti | AAEL012770-PA | ortholog many-many
Aedes aegypti | AAEL012773-PA | ortholog many-many
Aedes aegypti | AAEL015476-PA | ortholog many-many
Aedes aegypti | AAEL015591-PA | ortholog many-many
Culex quinquefasciatus | CPIJ015953-PA | ortholog many-many
Culex quinquefasciatus | CPIJ015954-PA | ortholog many-many
Culex quinquefasciatus | CPIJ017198-PA | ortholog many-many
Culex quinquefasciatus | CPIJ017199-PA | ortholog many-many
Culex quinquefasciatus | CPIJ017200-PA | ortholog many-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: NA