ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB52265.1'
Gene ID: ZHAS_00020381
Protein ID: KFB52265.1
Description: cytochrome P450, CYP 4C28
Location: KE525369.1:1885585:1891286:forward strand[JBrowse]
Sequence: >ZHAS_00020381  (1599 bp)    All exons in this region
ATGACATTGGAGAGTGTTCTGGCGGGGGCGGAACCCTTGTGGAGCCGCCCGATACCGAGAGCCTTCCTGCTCGTGTCGCCCACGAGCTGGATCGTGCTGCTCGCCCTGGCCGTCTCCTGCGCCATCGTGTACCGGCAGAGGTCGCGGCTGGTCAAACACATCGACCGCATTCCCGGACCGGCCGCCCTGCCCCTGCTGGGCAACAGTCTGCAGTGGCTGGTTGATCGCGATGGTAAGCACCAATTAGCGCGTAGTTGAGCCCACGAGGTTCTAATGTGCGAAGAAGGTCAAGTACTAGCTCATGCACCCCGCAAAACCTCAGCGTTTGACTTCAATCAACAGTCATCGATCAAAACAGGAAGCTGCAGTGTGGTACTGAAGATCAGATCAGACTCCTCTTCTGATTACTCGGAGCAATGGTGTATGTGTGGGTGTGTTTGTGAGTAGAATCATATTATCCAAATCTTCCTGCGAAATGCTCATCTCCAGAATCGGATTCCACCGAAATGGGAGGACATTTATTTTGTCTGCCATCTTTGTTTCCTGCTCTTCTGAAGCAAGTTCTGCGCATCTGACGGCGATGGATCTGTTTTTCGCGGTGAACCTTTACCGTCCATTTAGCCTTGCCAACGACCGACACCGAGGCACTATAAATTATCACGTTTGCTCGTTTTACGTCACCAGATTTCGAGCCAACTCGGGTGAATCGTACCGCCCCGAAATGCGCTGCTCCATCAGGTCTGGGTTCCCGTGCCGTTTGTTGGGTTATTAAATTGTAGCCTTCTCTCTGCAGCTCGTGGCAGAGTTCTCGCCGCTTTCTACGCATCCGCGTAAACATTAGTCTTACCCATCCTGCCCTTAGAAACCGTGGGCTAAAACACACACACACCGCACGCCGAAAAGCATCTGCCTCTAATGTCGCCAGCGCCCGGACGCGACTCCAGGGGCGGAGAATTTCGGCCGTACATCCGTCAGGCGTGACTAATGATGATGGACTCCGCCTGCCCGCGTCCGTCCTCTATCGCTTCGGCCACCCTCGATGCGTCGCTGCCTAACTAATGAGCCGGGGCACACACTGGGCGTCGCGCAAAACAGTCGCGCCATCCGTCAAATAAGTGCATCTGCACGGCATAATTAATTTGATTTTCTAATCCATCGGAGATCGGGAGAGAGGAGCGGAAAGGTGTCGAGGATAATTGGTTGCCATTTATCGAGTGTGCTGTATGGAGAAATGGCACCGAATATCGTCAACCCGGCTACCGGAGCGCTGCATATTTTTAGGTCCAATTATTTAAAAACGCGCATCCATAAATCGTTCGGTGGAAGGCGAAGGAATAGCATCATTTCCTAGCGATTAGCTTCCTAACGGCTCGGAACGTCAACCGATGGTTCCACCTACAGCGTAGACTTTGGTTATCAAGAGCGCACAGCCAGCGTATGTCAGAGTATTTCGGTACCTTGACTAAGTGATACGCAAATTGCCGCAAACCATCAGCATTACCGTTCGGCACTTTCGCTCGCCTCTGGCAAAGGGCACCGAACGTCTGGTACCAGTCAGTTTTTGGTAAAGTGAACGGATGCTGCAAGCACCTGATTACACCTCTTCGCTGCCGATCGGGTGTCGATGGCCTTGCCTATGTACCAAGGACATCCAATGGGCCAGGGGGCGGGTTTCCAACAACTGCTTTCTTGATTAATCCTTTTCCTCGGCCTTGGGCACGAAATTGCGGAACACATCGGCATCGAGCTGGAATTGCAGCTGGCTGCTTATGAGTCTTATGAGACCTGAGCGCAATAACCATTATGATAAGTACTAAGGCACCTTTAGAAAATTTGGAGAAAAACCTTTCGTTGGATATTTAACGATTGCTAAGGTCACACTTTATTTCAATTTCTCCTTCTCTGGATTCGGTGGTATCAACTCCAAAGTAATCAGCGAAAAATTTGCGGTATCTGAGGAGTTGCATACCAAGGCTCCTTAACGTTTACAAGGTGCCGCTATATGATTACTATCTTTCGTTGAGGTGTACTTTCATGCTTATTTAATTCTTTTAACCATATCGCTCGGGGAAGTTCAACCCGATGAGTTCATTCACGCCACCGACCTACCAAGGAAGTGATTGCACGCGGTTTATCCACCGGTTGACGGATTATGCTTGGCGGCTTCATTTATGGTCATTAGCGCACGATGCGCCTTTCCCCACCGCGGAGGTGGAGGCCACCTGAATCGTTTGCCTTCCCAGTATAGCACTTTACGACTCCCTTAAATCCCACTCTTCCGTGAATCTCTTCTTTCACGCCTTGTTGGGGTGGTCTACCGCAAGTTGTTGATCTTGTCTCAGGCTGTACAGGTCTGTAACGCCAGAAACGCTAGTACTTACCTTTTTTTAATAACAAGCGATGCGGTCCAATTGCATACATTTAGGCGCAAAGATGATTAAAAGCTCGCGATGCGCTTAACGCCACTGAATGCATTGCAGTTGATGCAGTTTGGTTTCTTCTTTTCTTTCTTGTATGACCCTACTCCGCAGAGATGTTCAACGTCATCACTGGTGCCAGGAAGCTGTACGGGCGCCGACAGGGATTCAACCGCGTGTGGGCCGGACTGAAGCCATACGTTCTCATTTCGAAAGCTACTGTAGCAGAGGTATGATAATTGATTCGTTCTTGTGAGAAGGTTTTGCGCTGCCAGCCAACATGTTTTAAGGCTCATATTTATTTTCCACTACTGCAGAAGATCCTCTCGAGCTCGAAAAACATCGAGAAAGGGCGCGACTACGATCTGCTGAAGCCCTGGATCGGCACCGGTCTGCTGACGAGCCACGCCGCCAAGTGGCACCAGCGCCGGAAGCTGCTGACGCCGACCTTCCACTTCAAGATACTGGCCAACTTCGTCGAGGTGTTCAACAAGCAGAGCGCGGTGCTGGTCCGCCAGCTGGCGAAGCAGCTCGACAACCGGGATGGCTTCGACTGCACGATCTACGCCACGCTGACCTCGCTGGACATCATCTGCGGTAAGGTTGCTTCTGCATTATTCATATCCAATCAATCATTCCCGAGGGTTCCATCAAATCGGATAAAGAGACAAGATCTGATGAGTGGGGTACAAATCATTTCTTTATTTCTTGTTTAGCCACGGTTTTATACGGATTTCAGATACCGGTTATGACTTCCTAGATTTATTCAATACAATATTTCCATATCGTCTTGCAACCGTTCGGAATTCCGGGTTAAAAATAACAACCATCATGAAGGTACTAAAGTTTTATGACAATGTGAAAATAGAGCCTAATATAACCGAATCCAACACAAAACGATCCATTGATACGAGAAGTCGCAAGTTAGAAGTTTGCTTCGGTGTATGATTCCCTTCCGTTCTACGATACTTCGTGCGTGAAAGAGTTAATCGAAAGCTAGACACGATATGTTGAGCGTTACTGGCGACATGAACACAAAAAATTGCGATTTTGCGCCACAGTGGTTAGATAATGAATGTAGGGGTACCTGGGGTAATATGCACCCCTTAAGGAAAACTATAGAGTTTTCAATCTAGCTTGTAGATTGATATATCCGACCAACTTGTTTTTGACCGTGGGCTGTCATACACCACGTCCAATGTACTCCATGTCTCTCCCAGTTTTTTGAATATAGAGATTGTCGAGGGCGCCCTAGCCAAGCTCAGGCCATCAAACTCACCAGGACCTGATGGCATTCCGGCCACTGTCCTTATTAGGTGCCGCTCGATCATTGCTCCATTGCTCTCTAAAATTTTTGAGCTCAGCCTATCCCCCTGTACTTTCCCTACTCAATGGAAAACTAGTTTCCTATCTCCTGTATTCAAAAAAGGCGATCGCAGTGTGATATCTAATTACCGTGGTATTTCCTTGCTCTGTGCCAGTGCTAAGGTTTTTGAATCTGTTGGCCATCCCCACGTATTGTTTCATACTCGTTCTTGGATCAGTATTCACCAGCATGGTTTTATGCCTGGGAGATCCACAACTACTAATCTAGTGCATTTTGTTTCCATTCTTTGCAAGAACTTAGACCGCCTCTGACAAGTAGATGTCATCCATACGGACTTCCGTTCTGCTTTTGACCATGTCTGCCACATTCTGTTGCTAGCAAATCTCGACAAACTTGGTTTCCCTTTCTCACTGCTTTCGTGGTTAAGTTCCTATTTGTCTGGGCAGTCCAGCAGAGTTAAACTCGGTGACTGCCACTCTGGAATTATTGCTTGTACCTCTGGGGTACCGCAGGGGAGTGTACTGAGTCCTCTCCTTTTCCTTCTGTTTATTAATTATATCCTATTCTTTATGCAGATGATCTCAATTTTTTTTCCCTATTGCTAACCTCTCCGGTTGTACCGTTCTTCAAGATTTCTCGGACGTATTTTTTGTGTGGTGCTCTTCAAACTTTTTATCCTTATGCCCCGAGAAATGCTTCCGCTCCTCTTTTTCATCTACTCCCGCTCTGTCCTAATCTTTGCCTTCTTTCCGCTTCTTGTCAATTCGCTTCCTCGTCGATCCTCACATGAGTTATATCTTTGTAGTCTGAGCCAGGGTTTAGCTTAAACAAAGTTTCATGGTGTTTGTAATATAATTTTAAGTTTGCATATTACCCCAGCCACCGCTAATCGTTCTCTCTGTCGTTGCAGAGACAGCCATGGGTTTCCCCATTCACGCACTGGAGCAGTCCGACTCGGAATACGTTAAAGCGCACGAAAAGTAAGTAGTCGAATCTCGAACAGGGCAAGCGAATGCAAGCTGAACTGACATTTCTTTTTTTTCTCGGGTGGAAATAGGATAGCGGAAATCATTCTCGATCGCTTGCAGAAGTTCTGGCTGCGTCCGGACTTCATATTCCGGTTCACCAAAGCGTATGCTGAGCACGAGCGCTGCTTGAAGGTGCTGCACGATTTCGCCTACCGCATGATCAGTGAGCGCCGGGAGATGTACAGGGAGCGGAAGCGAAACGCCGAGCGGCCCGAGGTGGACGACACGGTGGAGATGGTGGGAAAGAAGCAGTTAGCCTTTTTGGATCTTCTGCTGGAGCTGTCGGAGGACGGTCAGCTGCTGACGGATGCCGACATTCGGGAGGAAGTGGACACGTTCATCTTGGGCGGGCATGATACCACGGCGACGGCCCTTGGTTGGATCCTGTACCTGCTCGGGACGGAGCCGGCGGTGCAGGAGCGTGTCCATGCGGAGATCGACACCATCATGGGCGGCGACCGGGAGCGCTTCCCGACCATGCAGGAGCTGAACGAGATGAAGTACCTGGAGTGCTGCATCAAGGAGAGTCTGCGTCTCTTCCCCAGCATCCCAATGCTCTCACGCTCCCTGGTCACCAGTGTGGACGTAGACGGGTACCACATCCCGGCCGGCACCAATGCGGTGATCATGCTCTACCAGCTCCACCGCGATCCCGAGTACTTTCCAAACCCGGAAAAGTTCTACCCGGACCGCTTCCTGCCGGAAAACAGCGTCGGCCGGCATCCGTACGCCTTCATTCCGTTCAGTGCCGGTCCGCGGAACTGCATCGGCCAGAAGTTTGGCGCACTGGAGGAGAAGGCCGTACTCTCGGCCGTGGTGCGCCACTACCGCATCGAGGCGGTCCACCGGCGGGAGGATCTCGTACTCTACGGTGACCTGGTGATGCGCACCAAAGAGGGACTCAAAATACGCATCTACAAGCGTGACTGA
Ortholog: Anopheles gambiae | AGAP010414-PA | ortholog one-one
Aedes aegypti | AAEL008018-PA | ortholog one-one
Culex quinquefasciatus | CPIJ018944-PA | ortholog one-one
Drosophila melanogaster | FBpp0085074 | ortholog many-one
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: NA