ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB52546.1'
Gene ID: ZHAS_00020698
Protein ID: KFB52546.1
Description: Glutathione S-transferases, Epsilon
Location: KE525396.1:1014049:1014851:forward strand[JBrowse]
Sequence: >ZHAS_00020698  (669 bp)    All exons in this region
ATGCCGAACATTGTGTTTTACACCTTGGATTTGAGCCCTCCGTGTCGCGCCATTGAACTTACGGTGAAGGCGCTCGGTTTGGAGTTGGAGCGAAAGACGGTGGATCTGTTGGGCGGTGACCATTTGAAACCCGAGTTTTTGAAGGTTTGTGCGGGTGTCTTTTTTGGGTGAATCGGACCTTTAGTAACTTTAGTCCAATCCACTACTCCAGCTAAATCCGCAACATACGGTTCCCGTGGTGGACGACGAGGGAACGATCCTGATCGAGAGTCATGCCATCATGATCTATTTGGTACGGAAGTACGGCAAGGACGATACGCTCTACCCGACGAATCTGATCGAGCAGGCTCGCGTCAACGCCATGCTTCACTTTGAAACGGGAGTTTTGTTTGCTCGAATGAGATTTATTACCGTAAGTTTTGGGCAAGCGTGAAGTGATGGAACTCTTTTGGTAATGTCCTGTTGTTTCCTTACCTTAGGAGTACATATTTTTTAAGCATCATGCCGAAATACCAGAAGATCGTATTGAGTACGTTCAGGCGGCCTATCGATTGCTGGAGGACAGCTTGACCAAGGACTTTGTGGCCGGTCCGAAGATGACGATCGCCGATTTCAGTTGTATCTCCACGGTGTCCTCCCTGATGGGCTTCATACCGATGGAGAAGTCGACGCATCCGAAAATCTACGCCTGGGTCGGGCGCATGAAGCAGAGTCTCCCGCACTACGAGGAGCTGAATGGAAATGGAGCTACCGCATTGGCGAAGGCCATTCGATCGGCGCAGGACGCCAACCGCAAGAAATAA
Ortholog: Anopheles gambiae | AGAP009195-PA | ortholog one-one
Aedes aegypti | AAEL007951-PA | ortholog many-many
Aedes aegypti | AAEL007964-PA | ortholog many-many
Culex quinquefasciatus | CPIJ018627-PA | ortholog many-many
Culex quinquefasciatus | CPIJ018628-PA | ortholog many-many
Culex quinquefasciatus | CPIJ018629-PA | ortholog many-many
Culex quinquefasciatus | CPIJ018630-PA | ortholog many-many
Drosophila melanogaster | FBpp0085876 | ortholog many-many
Drosophila melanogaster | FBpp0291657 | ortholog many-many
Drosophila melanogaster | FBpp0293852 | ortholog many-many
GO: GO:0005515:protein binding
KEGG: Orthology:K00799
Pathway name:Metabolism of xenobiotics by cytochrome P450
Pathway map:ko00980