ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB53108.1'
Gene ID: ZHAS_00021402
Protein ID: KFB53108.1
Description: cytochrome P450, CYP 325H1
Location: KE525413.1:265115:267454:reverse strand[JBrowse]
Sequence: >ZHAS_00021402  (1506 bp)    All exons in this region
ATGATTGTGCTAGTGTTCATAGTCGTGTTCGCACTGGCGTACTATGTCAACTTTCGGCGCTCCCGCAAGCGGCTCTACGAGCTCGCGAAACAGATCCCGGGCCCGTTCGACTATCCGCTGATCGGCAGTATCCTGATCACGCTCGGCAAAAATCCGCTCCAGCTGGTGTCGCATCTGATGGAGCTGATGCACCATCTGCCATCGCCGATGCGTGCCTGGCTCGGTCCGTACCTGCTGGTGGTCATCGACCAGCCGGCGATGGTGCAGGACGTGCTAAGCTCACCGGACTGCGTCCAGAAGCCGTTCATGTACGATTTCTTCCGGATCAGCAAAGGCCTGTTCGGTGCACCGGCCGACACGTGGCGCCGGCACCGGAAGCTCCTGAACACGTCCTTTTCGCCGGTCGTGCTGAAAAGCTTCGTGCCAATGCTCAACGAGAAGGCGGACGGGTTCGTGCACGAGCTGGCCGCCGAGGCGTCGGCCGGAACCTTCGATGTGCACAAACCGCTCGCCCGGTACACGGTGGTCAGCATAGCGTCGACCACGTTGGGCGTCGATCTGAGCGTTGAGAAGCGGGACACACTCGAGGAGTACAGCAGCAATGCCATCGAGTAAATGGGCGACCGGCGGGAAGGGCCAGGTACAGATCGATCCTAACGCACCGTTTCTTTCGTCAGGTTGTTTACGGCGTGCTTCGAGCGGATCTACAAAGCCTGGTTGCATCCCGAGGTGATCTTCCGGCGGACGAACGCCTTCCAGGTAGAGCAAAAGCGGATGCAAACCTTCAAGAAAATGTCCAAAAAGGTAAGTTAAGAACTTCCCGGGAAGATGAAACGCACCGATGAACCTTGTGTCGTAATTTATAAGTCCTATATGTGCTCTATTTGTGTTTGGTATGAAAAGTATACCGAAAGTATTCTTGCCCAATGGTTAACAAATTTAAAAAATGAAAAAAAGGATTTTAAAAATCACTTACAATTGTTCATAAAGCGACTCAAAAGGATTAAAAAACAAATCAGACTCCTGGTCCGAATAGCAACAATAAAGTTACTCCAGAAGCTGAAAACATCGCTAGGCAACATTTTGCTATTTCAAACGAGTATTTTGTTAAAAAGGACTAATTATGCAAAAAGTCGATTTTTGAAACGATATTCGAAGGCTTTATTTTATCTAACTTGGTTTTAAATTTAATTGGTGGTACGTATGCCATTTTATAGTTTAAATTAATACATTTTATTAAAACAGCAAAATCTTGGGATCCACAATTTCACCAACGGTAAAGATCTTCAGTATATTGAAAATAAAAACATCCGCATTTTTTTCTGCACGATCATTCACAATTAGAATAAATAAAAATGCATAATCACTTGGAGCTAATTAACTGAACAAATCGTTCTTTTCAAGCTCGTTTTAATTGCATAGAACTTTACATTAGACCTGGAGTGCCGCGGAAACAAGTTCTGAAAACAATAACTTTATTAAATATTGCCAAATATGGGTTTATGAAAAAGATGCTTCCTCCTAAAATGAAGAAGTACATCGTGCGCCTTAACGTGAGCCTTTTTGTTGCAGATTATCACCCTACGCCAGCACGTGCTTGCCCAGGAGAGCGGTCACGATCGGCAGGATTCCGATCCAGAGGACAAACAGGATACATCCCCCAGGGGGAAAATCTTCATCGAACGTCTGGAGGAAATGGCCCGCGATCCGGCCCTCCACATCGACGACGACGGCTTCCAGCAGCACATCGATACGCTGCTGTTCGGTGGCAACGACACGTCCGCGCAAACCCTCGCCAACACCATGCTCACGCTCGGCATGTACCCGGAGCTGCAGGAAAAGGTGTACCAGGAGATCGTCGACGTTTGCCCCAGCGGACCGATCGCGTACGCCGACCTGTCCCGACTCGTCTACATGGAGATGTTCGTAAAGGAAACGCTCCGCCTGCTGCCCATAACGGGTCTGATCGCGCGCGCCCCAACCAGGGAGATTCCCTCGAGGGGCATCACCATTCCGAGCGGGGCCATCGTGATGGTTCCTCTGCTGAAAATGCACCGTGACAAGAAAATCTGGGGCCCGGACGCGGAAACCTTCGACCCGGACAACTTCCTCCCGGAACGGTGCATCGAGCGACACCCGTACAGCTTTATCCCGTTCAGCCAGGGACCGCGGAACTGCATCGGGATGAAGTACGGCTGGTTGTCGATGAAAATCCTGCTCTGCCACGTGCTCCGCCGGTATCGCGTTAGTACCGACATAAAGTTGCGCGACATTAAACTGTCCCTGTCGTTGGTGATGAAGCTGAACACTAAACATATGATACGGCTTGAACGGCGGTAG
Ortholog: Anopheles gambiae | AGAP002138-PA | ortholog one-one
Aedes aegypti | AAEL000340-PA | ortholog one-one
Culex quinquefasciatus | CPIJ015960-PA | ortholog one-many
Culex quinquefasciatus | CPIJ015961-PA | ortholog one-many
Culex quinquefasciatus | CPIJ015962-PA | ortholog one-many
GO: GO:0005506:iron ion binding
GO:0009055:electron carrier activity
GO:0020037:heme binding
GO:0055114:oxidation-reduction process
KEGG: NA