ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB53518.1'
Gene ID: ZHAS_00021746
Protein ID: KFB53518.1
Description: Glutathione S-transferases, Delta
Location: KE525420.1:1108109:1108827:forward strand[JBrowse]
Sequence: >ZHAS_00021746  (642 bp)    All exons in this region
ATGGATTTTTATCATCTTCCTTTGTCGGCACCATGCCAGTCTGTGCGGCTAGTGGCCAAAGCCCTCGGGCTCCATCTGAACCTGAAGGAGGTCAATCTGCTGGCAGGAGAACACTTGAAACCGGAGTTTTTGAAGGTGAGCCCGAGGCCGGAAATTAATTGTCGGTATCATTTTTATTTTATGAGTGAGTGTTTCCTCCGTTCCCCAATCAGATCAATCCCCAACACTGCATCCCAACGCTGGTCGATAACGACTTTGTGCTGTGGGAGTCGCGTGCAATTTTGACGTACCTGTGTGAAAAGTATGGCAAAAACGATGGCCTATACCCGCGCGATCCGAAAAAGCGTGCCGTCGTCAACCAGCGGTTGTACTTTGACATGGGAACGCTGTACGGGCGGTTCTCCGCCGCGTACTACCCGATGATGATGGACGGAAAGGAGCTGAACCCTGAGCTGGTGGCCAAGCTTGACGAAGCGTTGGAGTTTCTGGAAGGATTTCTGGACAAGACTCCGTACGTAGCGGGCGATAAGCTTACGGTGGCCGATTTGGCGGTTCTGCCGAGTCTGACAACGATCGAGGTGCTTGCCTCGTACGATCTGAGCAAGTTCCCGAACATCCAGCGTTGGTACGGTGAGGTGAAGCAGTCCGTTGCTGGATATCAGGAAATTTGTGCCGAAGGTGCCGCCGAGTTCAAACAGGCGTTTATGCCCGGTAGCTAA
Ortholog: Anopheles gambiae | AGAP004378-PA | ortholog one-one
Aedes aegypti | AAEL010582-PA | ortholog one-one
Culex quinquefasciatus | CPIJ002680-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002681-PA | ortholog one-many
Culex quinquefasciatus | CPIJ002682-PA | ortholog one-many
Culex quinquefasciatus | CPIJ010814-PA | ortholog one-many
Drosophila melanogaster | FBpp0082041 | ortholog one-many
Drosophila melanogaster | FBpp0082042 | ortholog one-many
Drosophila melanogaster | FBpp0082043 | ortholog one-many
Drosophila melanogaster | FBpp0082045 | ortholog one-many
Drosophila melanogaster | FBpp0082046 | ortholog one-many
Drosophila melanogaster | FBpp0082047 | ortholog one-many
Drosophila melanogaster | FBpp0082077 | ortholog one-many
Drosophila melanogaster | FBpp0082078 | ortholog one-many
Drosophila melanogaster | FBpp0082079 | ortholog one-many
GO: GO:0005515:protein binding
KEGG: NA
EXPRESSION:
Technology Comparison Life_stage Regulation Fold_change P_value Study Source
Transcriptomics Female/Male Adult Up 1.78812885 4.60E-10 BMC Genomics. 2014 Jan 18;15:42. PRJNA339810
Transcriptomics Deltamethrin-resistant strain/Deltamethrin-sensitive strain Female Adult Up 1.50972295 0.0118891868 PLoS One. 2015 Nov 20;10(11):e0143387. PRJNA293400