ASGDB (or) NCBI Accession number :
e.g. ZHAS_00002221, KFB35468.1
 
Gene name (or) symbol :
e.g. CYP 307B1
 
GO ID :     more details
e.g. GO:0005506
 
GO term : 
e.g. iron ion binding
 
KEGG ID :
e.g. ko00981
 
KEGG annotation :
e.g. Insect hormone biosynthesis
 
search for 'KFB53929.1'
Gene ID: ZHAS_00022173
Protein ID: KFB53929.1
Description: AGAP010848-PA-like protein
Location: KE525423.1:1146899:1148150:forward strand[JBrowse]
Sequence: >ZHAS_00022173  (1008 bp)    All exons in this region
ATGACTTGTTGTTTTTTCGGTGGGTTTTTGTTTTGGTTGTCACCTGGTCCACTGGCAACTTGTGAAACTAATTTCTCGCTTGGTTCGTTGTCGAGATTCATCGTTTGGTTGGCTTTTTTGCTCGTAGAGGAACTTGCATTCCATCGCGAACTGATGGTTTGGTGGTTTTGCTGACTCAGCTGTCATTCCTGTCGTTACTCAATGTTTTCGTTTCTTCTATTTCTTTTCTCTCCAGTTGGCAACGGTGGCTACGGTCGCCACGGCTCTGCACTACGGCGATGAGGGAATCGACGTGAAGATCAACGTGGAGCAGAACTCCAACTCGTACCTGTCCGGGCGGCTGCCGCAGGGTTCGTTCGAGTACGGGCTGGACGTGGTGAAGCAAAAGGACAACCACTTCCAGCACAAGGTGAAGGGCCCGGACGATGTGACGTACGGCTGCTACGGGTTCGTCGATCCGGACGGCAAACCGCACCTGGTGCACTACGTGTCCGACCTGAAGGGCTACCGCATCGTGCCACCGGAGTCCGCCACCAAAATCTACATCTCGCGCCTCGAGCGAAGCATGTAAGTAGTACTGCTCGAATAACCATTTCGAGCTGTTTATTCGATTGCATACCACCAGGCGCTTGGGAGGGAAAACGTGATGCTTGAAATCGTTGTACTGAGGAAAATGTCAGGATTGAGATTTAATTTTCCACCCCTTCCACCTCACCCCTTCCCTTCCTCCAGTAACAACGTCTACCAGGCCTCGCAGGAGAAGAACGTGCAGTGGAAGGACCTGTTTTTCCCGCCCGCCTGCCAGCAGCTGTATAGGGAGCAGAAAGTAGCGACCACTCCCCGACCGACGCCCCGTGTCTTCACCACCCCTCGTCGCCCGGCTCCCACCCAACCCCGCCGCGTGGCCCCCACGATTACCACAACCCCCGCACCGGTCGAGCCGGAGCCGAGCTCGAGCAACCTCTGCCCGTCGGTCGTCCAGGTCCCGCCAGCCAACCTCGCTCCCCAGCCCGCCTGCTCCGCCGTGTGTGACGAGCTGAAGAACGAGCTGGCCGACATCAAGTCGAAGCTGAAGACGCTACTGGATGCGGTGGCGGAGAAACCGAGTGGCAAGGCCGGACCGAAGGGCAAGGGTAACGCCACGTTCGCCTACTTCCCGGTGATGCTGAGTGACGGGCTGCCGGAGGGCGTCGATGCCGATTCGGCCAAGTTTGCCTTCCCGGCCGTCCCGCAGCAGTGTGGCCGCCAGTGA
Ortholog: Anopheles gambiae | AGAP010848-PA | ortholog one-one
Aedes aegypti | AAEL011029-PA | ortholog one-many
Aedes aegypti | AAEL011032-PA | ortholog one-many
Culex quinquefasciatus | CPIJ012076-PA | ortholog one-one
GO: GO:0042302:structural constituent of cuticle
KEGG: NA